View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8676_low_19 (Length: 206)
Name: NF8676_low_19
Description: NF8676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8676_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 4338638 - 4338766
Alignment:
| Q |
1 |
tagcaactctcactctaacacttcattggatgaatttcatgaagggttcaacgcattatatgagatccatttccaaagtggcgggacaatgcataaaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4338638 |
tagcaactctcactctaacacttcattggatgaatttcatgaagggttcaacgcattatatgagatccatttccaaagtggcgggacaatgcataaaatt |
4338737 |
T |
 |
| Q |
101 |
tatccagaaagaatattagagttagagtg |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4338738 |
tatccagaaagaatattagagttagagtg |
4338766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University