View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8676_low_20 (Length: 204)
Name: NF8676_low_20
Description: NF8676
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8676_low_20 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 132; Significance: 9e-69; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 15 - 186
Target Start/End: Original strand, 31786142 - 31786316
Alignment:
| Q |
15 |
agagagaaatgcctgccctcaaccatagagttcaatacacaacaaattgccacttttaaatcattagaataacactaaattttgtaattttgatc-ttct |
113 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
31786142 |
agagagaaatgcctgccctcaatcatagagttcaatacacaacaaattgccacttttaaatcattagaataacactaaattttgtaattttgatcattct |
31786241 |
T |
|
| Q |
114 |
agtgataatttttcat--tttatactcatatttttctaagtgtgcttaatatacttggaaatatagatcttattt |
186 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||| |||||| | |||||||||||| ||| ||||||||||||| |
|
|
| T |
31786242 |
agtgataatttttcataatttatactcatatttttgtaagtgggtttaatatacttgaaaagatagatcttattt |
31786316 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University