View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8677_high_3 (Length: 284)
Name: NF8677_high_3
Description: NF8677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8677_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 101
Target Start/End: Complemental strand, 9478515 - 9478415
Alignment:
| Q |
1 |
tcgatgctcacttccttaaagttgattttgtctaaatcagccatattatccacaacagtaggaacattgaaattgcaggtaatatcgattttctggattt |
100 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
9478515 |
tcgatgctcatttccttaaagttgattttgtctaaatcagccatactatccacaacagtagcaacattgaaattgcaggtaacatcgattttctgggttt |
9478416 |
T |
 |
| Q |
101 |
t |
101 |
Q |
| |
|
| |
|
|
| T |
9478415 |
t |
9478415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University