View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8677_low_3 (Length: 302)
Name: NF8677_low_3
Description: NF8677
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8677_low_3 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 15 - 290
Target Start/End: Complemental strand, 5960740 - 5960465
Alignment:
| Q |
15 |
agtttgaagcgtttatgatttgcatcaaaggaacatacaacatgtaaagaacaagggaggactagaagaatatttggggtgtggaagagtgtttaacgat |
114 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5960740 |
agtttgaagcatttatgatttgcatcaaaggaacatacaacatgtaaagaacaagggaggactagaagaatatttggggtgtggaagagtgtttaacgat |
5960641 |
T |
|
| Q |
115 |
tgatgatagtcctttaaccaaagagtacggtgaagaggatgtggagtgggagtctcactcatttgctccatttgtgaaaatagggatgaaagtgccattc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5960640 |
tgatgatagtcctttaaccaaagagtacagtgaagaggatgtggagtgggagtctcactcatttgctacatttgtgaaaatagggatgaaagtgccattc |
5960541 |
T |
|
| Q |
215 |
atacattcaaggattgtgttcatgtaatccgtattttgctttggatagttaaatctaatcaaattaccgagagtat |
290 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5960540 |
atacattcaaggattgtgttcatgtaatccatattttgctttggatagttaaatctaatcaaattaccgagagtat |
5960465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University