View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8678_low_4 (Length: 222)

Name: NF8678_low_4
Description: NF8678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8678_low_4
NF8678_low_4
[»] chr4 (1 HSPs)
chr4 (107-212)||(53700930-53701035)


Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 107 - 212
Target Start/End: Original strand, 53700930 - 53701035
Alignment:
107 ccaattacggaacatgcaaaaactccattaaacatgattaatcatatcaaacgttctgatcttaagatgtgtctgttgttggtgtttccacactttctgt 206  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
53700930 ccaatcacggaacatgcaaaaactccattaaacatgattaatcatatcaaacgttcttatcttaagatgtgtctgttgttggtgtttccacactttctgt 53701029  T
207 tcttct 212  Q
    ||||||    
53701030 tcttct 53701035  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University