View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8678_low_4 (Length: 222)
Name: NF8678_low_4
Description: NF8678
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8678_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 107 - 212
Target Start/End: Original strand, 53700930 - 53701035
Alignment:
| Q |
107 |
ccaattacggaacatgcaaaaactccattaaacatgattaatcatatcaaacgttctgatcttaagatgtgtctgttgttggtgtttccacactttctgt |
206 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53700930 |
ccaatcacggaacatgcaaaaactccattaaacatgattaatcatatcaaacgttcttatcttaagatgtgtctgttgttggtgtttccacactttctgt |
53701029 |
T |
 |
| Q |
207 |
tcttct |
212 |
Q |
| |
|
|||||| |
|
|
| T |
53701030 |
tcttct |
53701035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University