View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8680_high_1 (Length: 222)

Name: NF8680_high_1
Description: NF8680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8680_high_1
NF8680_high_1
[»] chr4 (1 HSPs)
chr4 (13-203)||(47123203-47123393)


Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 203
Target Start/End: Complemental strand, 47123393 - 47123203
Alignment:
13 gagatgaagaaacacaaagctttgggaaagtatattggagcaatgtttgcatgtgatggctagagcaaaagaggtatttagcttatggcagtttgcacac 112  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
47123393 gagaagaagaaacacaaagctttgggaaagtatattggagcaatgtttgcatgtgatggctagagcaaaagaggtatttagcttatggcagtttgcacac 47123294  T
113 aaggagacgcacaacagaaaacagacaagtcgaattgaaaacacgggttggatgcttcctttatgactatgtaatgtgtaatcttgatgta 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||    
47123293 aaggagacgcacaacagaaaacagacaagtcgaattgaaaacacgggttggatgcatcctttatgactatgtaatgtgtaatcttgatgta 47123203  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University