View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8680_low_4 (Length: 222)
Name: NF8680_low_4
Description: NF8680
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8680_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 13 - 203
Target Start/End: Complemental strand, 47123393 - 47123203
Alignment:
| Q |
13 |
gagatgaagaaacacaaagctttgggaaagtatattggagcaatgtttgcatgtgatggctagagcaaaagaggtatttagcttatggcagtttgcacac |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47123393 |
gagaagaagaaacacaaagctttgggaaagtatattggagcaatgtttgcatgtgatggctagagcaaaagaggtatttagcttatggcagtttgcacac |
47123294 |
T |
 |
| Q |
113 |
aaggagacgcacaacagaaaacagacaagtcgaattgaaaacacgggttggatgcttcctttatgactatgtaatgtgtaatcttgatgta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
47123293 |
aaggagacgcacaacagaaaacagacaagtcgaattgaaaacacgggttggatgcatcctttatgactatgtaatgtgtaatcttgatgta |
47123203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University