View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8681_high_7 (Length: 250)

Name: NF8681_high_7
Description: NF8681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8681_high_7
NF8681_high_7
[»] chr2 (1 HSPs)
chr2 (180-238)||(6689885-6689943)


Alignment Details
Target: chr2 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 180 - 238
Target Start/End: Original strand, 6689885 - 6689943
Alignment:
180 aagaatctaatatttagcataaggttctagcgtactccaatgcattattcctacattca 238  Q
    |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||    
6689885 aagaatataatatttagcataaggttctagcgtactccaatgcattattcctacattca 6689943  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University