View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8681_low_13 (Length: 246)
Name: NF8681_low_13
Description: NF8681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8681_low_13 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 18 - 191
Target Start/End: Original strand, 30946200 - 30946372
Alignment:
| Q |
18 |
attttggaacgtcatttgtggcgtgtgcacaccttctgcagtttaaagcaacgtgagggcatttcgcgacggttagagccaacaactggaataagcgcca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
30946200 |
attttggaacgtcatttgtggcgtgtgcacaccttctgcagtttaaagcaatgtgagggcatttcgcgacgattagagccaacagctggaataagcgcca |
30946299 |
T |
|
| Q |
118 |
agagggcattctgcggctgtctatattttgcggtttttcactttggtcatggcattcgcggcgggttccaaact |
191 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| ||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
30946300 |
agagggcattccgcggctgtttatattttgcggtatttgactttggtcatggcattcgcggc-ggttccaaact |
30946372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University