View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8681_low_17 (Length: 242)
Name: NF8681_low_17
Description: NF8681
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8681_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 9 - 242
Target Start/End: Complemental strand, 36606574 - 36606341
Alignment:
| Q |
9 |
ggacatcatcggttacctaa---tcatctgccacatgtttctagagagcctttgaaggcttttgaaagtagtaccaaaggaatgcaagcaaccagcaaca |
105 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606574 |
ggacatcatcggttgcctaacggtcatctgccacatgtttctaaagagcctttgaaggcttttgaaagtagtaccaaaggaatgcaagcaaccagcaac- |
36606476 |
T |
 |
| Q |
106 |
attctgtttcatcttcagtctccattcaaggatttgaactttttgacttcgcaaacacttttattgacttgagtgaaccaacaccccctgaacatgggag |
205 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606475 |
--tctgtttcatcttcagtctctattcaaggatttgaactttttgactttgcaaacacttttattgacttgagtgaaccaacaccccctgaacatgggag |
36606378 |
T |
 |
| Q |
206 |
ttttaatcacactgaaattgtgggatcacgtgccaac |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36606377 |
ttttaatcacactgaaattgtgggatcacgtgccaac |
36606341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University