View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8682_high_5 (Length: 285)

Name: NF8682_high_5
Description: NF8682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8682_high_5
NF8682_high_5
[»] chr7 (1 HSPs)
chr7 (69-267)||(13752562-13752760)
[»] scaffold0755 (1 HSPs)
scaffold0755 (1-60)||(4392-4451)
[»] scaffold0072 (2 HSPs)
scaffold0072 (1-60)||(48434-48493)
scaffold0072 (1-45)||(49178-49222)
[»] chr2 (2 HSPs)
chr2 (1-60)||(202846-202905)
chr2 (1-54)||(203515-203568)
[»] chr6 (1 HSPs)
chr6 (1-54)||(22681485-22681538)
[»] chr8 (1 HSPs)
chr8 (1-53)||(32327069-32327121)


Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 69 - 267
Target Start/End: Complemental strand, 13752760 - 13752562
Alignment:
69 ttttttaacttataaatactaatgttaatatgtttgttgataatctttgcttttatttacattgtcatgctatcatgaaagagaaaacgtaaattaagat 168  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13752760 ttttttaacttataaatactaatgttaatatgtttgttgataatctttgcttttatttacattgtcatgctatcatgaaagagaaaacgtaaattaagat 13752661  T
169 aatattctctagtttaatttcactgtccagattgtgtgattgcctcagtgtatgtgcttctatgagtttagatgcttattttctttgtaatcctattat 267  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13752660 aatattctctagtttaatttcactgtccagattgtgtgattgcctcagtgtatgtgcttctatgagtttagatgcttattttctttgtaatcctattat 13752562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0755 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0755
Description:

Target: scaffold0755; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 4451 - 4392
Alignment:
1 taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcactgaagtg 60  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
4451 taattagcattgccacgtgtcaaaatctgattggggcaatggcaccatggcactgaagtg 4392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: scaffold0072
Description:

Target: scaffold0072; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 48493 - 48434
Alignment:
1 taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcactgaagtg 60  Q
    |||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||    
48493 taattagcattgccacgtgtcaaaatctgattagggcaatggcaccatggcactgaagtg 48434  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0072; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 49178 - 49222
Alignment:
1 taattagcattgccacgtgtcaaaatctgattggggcaatggcac 45  Q
    |||||||||||||||| || |||||||||||||||||||||||||    
49178 taattagcattgccacatggcaaaatctgattggggcaatggcac 49222  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 202905 - 202846
Alignment:
1 taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcactgaagtg 60  Q
    |||||||||||||||||||||||||| ||||||||| |||||||| ||||||||||||||    
202905 taattagcattgccacgtgtcaaaatttgattggggtaatggcacaatggcactgaagtg 202846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 203515 - 203568
Alignment:
1 taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcact 54  Q
    |||||||||||||||||||||||||||||||||||| |||||||| ||||||||    
203515 taattagcattgccacgtgtcaaaatctgattggggtaatggcaccatggcact 203568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 22681485 - 22681538
Alignment:
1 taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcact 54  Q
    |||||||||||||||||||||||||||||||| |||||||||||| ||||||||    
22681485 taattagcattgccacgtgtcaaaatctgatttgggcaatggcaccatggcact 22681538  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 32327121 - 32327069
Alignment:
1 taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcac 53  Q
    |||| ||||||||||||||||||||| |||||||||||||||||  |||||||    
32327121 taatgagcattgccacgtgtcaaaatatgattggggcaatggcaaaatggcac 32327069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University