View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8682_low_5 (Length: 300)
Name: NF8682_low_5
Description: NF8682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8682_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 46 - 272
Target Start/End: Original strand, 14192871 - 14193097
Alignment:
| Q |
46 |
ggttgctcaatatgtggaggtctggaacgatcatcgggttgctagaattgtgcagagggcattcggttaccctttacaaaataccaggggctgtgctcat |
145 |
Q |
| |
|
|||||||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||||||||||||||| |
|
|
| T |
14192871 |
ggttgctcaacatgtgcaggtttggaacgatcatcgggttgctagaattgtgcagagggcattcggttaccctcttcagaataccaggggctgtgctcat |
14192970 |
T |
 |
| Q |
146 |
atacttgattttatgcacttttctactgtgacagacagccggattagagatgcaaagccagcaaggcaagagctagttcgatgcgctactaagcttctag |
245 |
Q |
| |
|
||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
14192971 |
atacttgatttaatgcacttttctactgtggaagacagccggattagagatgcaaagccagcaaggcaagagctagttcgatgcgctactagtcttctag |
14193070 |
T |
 |
| Q |
246 |
ctgctgggataatcatcattccagtac |
272 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
14193071 |
ctgctgggataatcatcattccagtac |
14193097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University