View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8682_low_6 (Length: 285)
Name: NF8682_low_6
Description: NF8682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8682_low_6 |
 | |
|
| [»] scaffold0755 (1 HSPs) |
| | |
|
| [»] scaffold0072 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 69 - 267
Target Start/End: Complemental strand, 13752760 - 13752562
Alignment:
| Q |
69 |
ttttttaacttataaatactaatgttaatatgtttgttgataatctttgcttttatttacattgtcatgctatcatgaaagagaaaacgtaaattaagat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13752760 |
ttttttaacttataaatactaatgttaatatgtttgttgataatctttgcttttatttacattgtcatgctatcatgaaagagaaaacgtaaattaagat |
13752661 |
T |
|
| Q |
169 |
aatattctctagtttaatttcactgtccagattgtgtgattgcctcagtgtatgtgcttctatgagtttagatgcttattttctttgtaatcctattat |
267 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13752660 |
aatattctctagtttaatttcactgtccagattgtgtgattgcctcagtgtatgtgcttctatgagtttagatgcttattttctttgtaatcctattat |
13752562 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0755 (Bit Score: 56; Significance: 3e-23; HSPs: 1)
Name: scaffold0755
Description:
Target: scaffold0755; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 4451 - 4392
Alignment:
| Q |
1 |
taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcactgaagtg |
60 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
4451 |
taattagcattgccacgtgtcaaaatctgattggggcaatggcaccatggcactgaagtg |
4392 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072 (Bit Score: 52; Significance: 7e-21; HSPs: 2)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 48493 - 48434
Alignment:
| Q |
1 |
taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcactgaagtg |
60 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
48493 |
taattagcattgccacgtgtcaaaatctgattagggcaatggcaccatggcactgaagtg |
48434 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 45
Target Start/End: Original strand, 49178 - 49222
Alignment:
| Q |
1 |
taattagcattgccacgtgtcaaaatctgattggggcaatggcac |
45 |
Q |
| |
|
|||||||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
49178 |
taattagcattgccacatggcaaaatctgattggggcaatggcac |
49222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 202905 - 202846
Alignment:
| Q |
1 |
taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcactgaagtg |
60 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
202905 |
taattagcattgccacgtgtcaaaatttgattggggtaatggcacaatggcactgaagtg |
202846 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 203515 - 203568
Alignment:
| Q |
1 |
taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcact |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
203515 |
taattagcattgccacgtgtcaaaatctgattggggtaatggcaccatggcact |
203568 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 22681485 - 22681538
Alignment:
| Q |
1 |
taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcact |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
22681485 |
taattagcattgccacgtgtcaaaatctgatttgggcaatggcaccatggcact |
22681538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 1 - 53
Target Start/End: Complemental strand, 32327121 - 32327069
Alignment:
| Q |
1 |
taattagcattgccacgtgtcaaaatctgattggggcaatggcactatggcac |
53 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
32327121 |
taatgagcattgccacgtgtcaaaatatgattggggcaatggcaaaatggcac |
32327069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University