View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8682_low_7 (Length: 273)
Name: NF8682_low_7
Description: NF8682
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8682_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 27 - 238
Target Start/End: Original strand, 14812781 - 14812993
Alignment:
| Q |
27 |
ccccgaacatcctttctccttatccaaacaaataatgtcccattgaatctactaaattttcttaacatcgtcacattagtgaaggttgattcacctgaca |
126 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14812781 |
ccccaaacatcctttctccttatccaaacaaataatgtcccattgaatctattaaattttcttaacatcgtcacattagtgaaggttgattcacctgaca |
14812880 |
T |
 |
| Q |
127 |
aggatttgattcatattctaaaagagcgtgtgtttaactctt-gctatcaatgtatgaatctttattgtagacaatccgtgagtacctctattaacattt |
225 |
Q |
| |
|
||||||||||||||||||| ||||||| |||||||||||||| | |||||||||||||||||||||||||| | ||| ||||||||||||||||||||| |
|
|
| T |
14812881 |
aggatttgattcatattctgaaagagcttgtgtttaactcttagttatcaatgtatgaatctttattgtaggcgatcaatgagtacctctattaacattt |
14812980 |
T |
 |
| Q |
226 |
ggttaaccttgac |
238 |
Q |
| |
|
||||||||||||| |
|
|
| T |
14812981 |
ggttaaccttgac |
14812993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University