View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8683_low_13 (Length: 252)
Name: NF8683_low_13
Description: NF8683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8683_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 6 - 107
Target Start/End: Original strand, 2139863 - 2139964
Alignment:
| Q |
6 |
tgtgtggaaaatggattaaaatatgtaatatgagtttgtaagactgtttataaaagttggaagtgggaagggagattttggaagttcgaaataggcacaa |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2139863 |
tgtgtggaaaatggattaaaatatgtaatatgagtttgtaagactgtttataaaagttggaagtgggaagggagattttggaagttcgaaataggcacaa |
2139962 |
T |
 |
| Q |
106 |
ta |
107 |
Q |
| |
|
|| |
|
|
| T |
2139963 |
ta |
2139964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 149 - 202
Target Start/End: Original strand, 2140002 - 2140055
Alignment:
| Q |
149 |
aaatggtgcgtggggtctaagtgggagctgttttatgttgctgtgcaaaatgca |
202 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2140002 |
aaatggtgcgtggggtctaagtggaagctgttttatgttgctgtgcaaaatgca |
2140055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University