View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8683_low_18 (Length: 228)

Name: NF8683_low_18
Description: NF8683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8683_low_18
NF8683_low_18
[»] chr2 (1 HSPs)
chr2 (84-217)||(8833279-8833411)


Alignment Details
Target: chr2 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 84 - 217
Target Start/End: Complemental strand, 8833411 - 8833279
Alignment:
84 atattctcaataacatcaacaccgacgacgtgtcactatatcaacccttcatctcttcactctccaatggagcatcttcttagatcacttcgatcatcgc 183  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
8833411 atattctcaataacat-aacaccgacgacgtgtcactatatcaacccttcatctcttcactctccaatggagcatcttcttagatcacttcgatcatcgc 8833313  T
184 gttttcgtttccgttcacttccttcttctcactc 217  Q
    ||||||||||||||||||||||||||||||||||    
8833312 gttttcgtttccgttcacttccttcttctcactc 8833279  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University