View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8684_high_5 (Length: 457)
Name: NF8684_high_5
Description: NF8684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8684_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 306; Significance: 1e-172; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 306; E-Value: 1e-172
Query Start/End: Original strand, 64 - 448
Target Start/End: Complemental strand, 2587719 - 2587333
Alignment:
| Q |
64 |
cttgctgtcggtttagatcggctttgtttgcttatgttgaccataattctattctgattctatccacgtttcttgtctgnnnnnnng-ttccattccatt |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
2587719 |
cttgctgtcggtttagatcggctttgtttgcttatgttgaccataattctattctgattctatccacgtttcttgtccgttttttttattccattccatt |
2587620 |
T |
 |
| Q |
163 |
ccacacatttactgcactgcactgcatagnnnnnnnnattttctagaaatctattactctctgatttttaagatttcagctgtttatagtattactgttg |
262 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587619 |
ccacacatttactgcactgcactgcatagttttttttattttctagaaatctattactctctgatttttaagatttcagctgtttatagtattactgttg |
2587520 |
T |
 |
| Q |
263 |
agcggaaatgttttgccgattttgcccctgttccctttttt-agagtttttgtaattgttgctctaaaggtttggatctagatattttgtttgtttaata |
361 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
2587519 |
agcggaaatgttttgccgatttcgcccctgttccctttttttagagtttttgtaattgttgctctaaaggtttggatctagatattttgtttgttaaata |
2587420 |
T |
 |
| Q |
362 |
ttttacaaactctgttctgtttgatgcatgaaccgttttttagctactaggcaagaaattagtgaagggttatttaaatatgatgtc |
448 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2587419 |
ttttacaaactctgttctgtttgatgcatgaaccattttttagctactaggcaagaaattagtgaagggttatttaaatatgatgtc |
2587333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University