View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8684_low_12 (Length: 245)
Name: NF8684_low_12
Description: NF8684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8684_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 6973843 - 6974083
Alignment:
| Q |
1 |
tatgtgtattgaatatgtaatg---tactaaatatcaacaaaaaggtacatgtatctggtccacattcgtaccagatgca--gacttttttacttatact |
95 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
6973843 |
tatgtgtattgaatatgtaatgatgtactaaatatcaacaaaaaggtacatgtatctggtccacattcgtaccagatgcatagacttttttacttatatt |
6973942 |
T |
|
| Q |
96 |
taagtttcgagtagtatcaaagaaaaatgcagctcacttattgctgcaacgaacataaaatcaagtggtttcgctggcataccctccatagatggatttc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6973943 |
taagtttcgagtagtatcaaagaaaaatgcagctcacttattgctgcaacgaacataaaatcaagtggtttcgctggcataccctccatagatggatttc |
6974042 |
T |
|
| Q |
196 |
atgtccattacattcctgatacttgtccagttgatgtccat |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
6974043 |
atgtccattacattcctgatacttgtccagttgatgcccat |
6974083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University