View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8684_low_13 (Length: 241)
Name: NF8684_low_13
Description: NF8684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8684_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 231; Significance: 1e-128; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 231; E-Value: 1e-128
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 6973746 - 6973516
Alignment:
| Q |
1 |
tatctaaacataacgtttgggtcatgaatgtagtacctgttcatgcaccggatacgcttcccataatttttgaacggggattttttggcgtctatcatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6973746 |
tatctaaacataacgtttgggtcatgaatgtagtacctgttcatgcaccggatacgcttcccataatttttgaacggggattttttggcgtctatcatga |
6973647 |
T |
|
| Q |
101 |
ttggtgcgagtcttttggtacttatccaagaacttatgaccttctgcatgctgatcatttgttctcacgcctcaaaaacaggtattggggaaatcttacc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6973646 |
ttggtgcgagtcttttggtacttatccaagaacttatgaccttctgcatgctgatcatttgttctcacgcctcaaaaacaggtattggggaaatcttacc |
6973547 |
T |
|
| Q |
201 |
agtattgttgtacttatcgatttcttgatgt |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6973546 |
agtattgttgtacttatcgatttcttgatgt |
6973516 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 151
Target Start/End: Complemental strand, 40607506 - 40607448
Alignment:
| Q |
93 |
tatcatgattggtgcgagtcttttggtacttatccaagaacttatgaccttctgcatgc |
151 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||| ||| ||||||| ||||| ||||| |
|
|
| T |
40607506 |
tatcatgattggtgcgagtcgtttagtacctatcctagatcttatgatcttctccatgc |
40607448 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University