View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8684_low_7 (Length: 408)
Name: NF8684_low_7
Description: NF8684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8684_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 363; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 363; E-Value: 0
Query Start/End: Original strand, 19 - 401
Target Start/End: Original strand, 25840747 - 25841129
Alignment:
| Q |
19 |
attcaacattctcctgattagccaatgataactccacaaactctacaccccaaagaatccaattatgtgtagcagaggtaggatcatcatgtgtaataga |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25840747 |
attcaacattctcctgattagccaatgataactccacaaactctacaccccaaagaatccaattatgtgtagcagaggtaggatcatcatgtgtaataga |
25840846 |
T |
|
| Q |
119 |
atttctccatggtggtgttccaccattacctctcaaatattttccacaccaacttctcagtttcacgttgaacccttcttttattggttcccattcatat |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25840847 |
atttctccatggtggtgttccaccattacctctcaaatattttccacaccaactcctcagtttcacgttgaacccttcttttattggttcccattcatat |
25840946 |
T |
|
| Q |
219 |
ttccagcccaaacccgcgtcgtaatcggcttggacaactttgtttccggtcatgccgaggagaaatggcgtgtctgtcgcggttaggtaacggccgtggt |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
25840947 |
ttccagcccaaacccgcgtcgtaatcggcttggacaactttgtttccggtcatgccgaggagaaatggcgtgtccgtcgcggttaggtaacggccatggt |
25841046 |
T |
|
| Q |
319 |
ggctcctgaggcgtatatggtgaggttttgtttcgaccggttcgattaaccatagtgattttttggttgttccatctctgctc |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
25841047 |
ggctcctgaggcgtatatggtgaggttttgtttcgaccggttcgataaaccatagtgattttttggttgttccatttctgctc |
25841129 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University