View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8684_low_8 (Length: 381)
Name: NF8684_low_8
Description: NF8684
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8684_low_8 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 334; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 334; E-Value: 0
Query Start/End: Original strand, 22 - 375
Target Start/End: Complemental strand, 24760688 - 24760335
Alignment:
| Q |
22 |
ccatcccttgaaatcgcgatctgggtcgtgacataaaagattttggtgttgctgaaaccacaatgcggccgcgattagtctaaattggccacatttgatc |
121 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
24760688 |
ccatcccttgaaatcgcgatctgggtcgtgacataaaagattttggtgttgctgaaaccacaatgtggccgcgattagtctaaattggccacatttgatc |
24760589 |
T |
 |
| Q |
122 |
acaattgcctacattatcagagatagcgacacaaccaccataacttaaaaccctaattgacgacggcataaagttttttaatgttgttgaaatcgcaatg |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | ||||| |
|
|
| T |
24760588 |
acaattgcctacattatcagagatagcgacacaaccaccataacttaaaaccctaattgacgacggcataaagttttttaatgttgctgaaaccacaatg |
24760489 |
T |
 |
| Q |
222 |
cggccacgattaggctacattggtcgcatttcatcacaattctccacaatatcgaagatcacggcgcaaccctcacttaaaaccctatttaaaacccgat |
321 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24760488 |
cggccacgattaggctacattggtcgcatttcatcacaattctccacaatatcaaagatcacggcgcaaccctcacttaaaaccctatttaaaacccgat |
24760389 |
T |
 |
| Q |
322 |
ttgaccgcaatcattatcacaatggctatttaaaaccctgcccccaccaccaaa |
375 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24760388 |
ttgaccgcaatcattatcacaatggctatttaaaaccctgcccccaccaccaaa |
24760335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University