View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8685_low_13 (Length: 206)
Name: NF8685_low_13
Description: NF8685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8685_low_13 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 206
Target Start/End: Original strand, 3361066 - 3361267
Alignment:
| Q |
1 |
tgcatgttcagtaacattgaggatgttctcatctagatgctgcttcaaattgaagaaaaacacagttaagtttgataccaagtgtgaagaagattaatat |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3361066 |
tgcatgttcagtaacattcaggatgttctcatctagatgctgcttcaaattgaagaaaaacacagttaagtttgataccaagtgtgaagaagattaatat |
3361165 |
T |
 |
| Q |
101 |
ttgtgtgcaagaagaaacaacaatatcatctaaagcactgaacttcatgtaattaaagccaaaccttgccatgagaatcttgccgatgatcttcaagtaa |
200 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3361166 |
ttgtgtacaagaagaaacaacaatatcatctaaagcactgaacttcatg----taaagccaaaccttgccatgtgaatcttgccgatgatcttcaagtaa |
3361261 |
T |
 |
| Q |
201 |
agcctt |
206 |
Q |
| |
|
|||||| |
|
|
| T |
3361262 |
agcctt |
3361267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University