View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8685_low_9 (Length: 244)
Name: NF8685_low_9
Description: NF8685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8685_low_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 130 - 233
Target Start/End: Complemental strand, 51434857 - 51434754
Alignment:
| Q |
130 |
cttatgtaaaatataatgacgatatgttcagtagttattaatgcaactagatctaatgtgcattatgggtgattttgtaggttttgattttgatgtttga |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51434857 |
cttatgtaaaatataatgacgatatgttcagtagttattaatgcaactagatctaatgtgcattatgggtgattttgtaggttttgattttgatgtttga |
51434758 |
T |
 |
| Q |
230 |
tgtc |
233 |
Q |
| |
|
|||| |
|
|
| T |
51434757 |
tgtc |
51434754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 51434986 - 51434884
Alignment:
| Q |
1 |
taactaccgatatatcttgatgtatgattgcttttattgtaatgccttaataattatagaagtttgcttgatcttcaaagtttcatcatagtctttcttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51434986 |
taactaccgatatatcttgatgtatgattgcttttattgtaacgccttaataattatagaagtttgcttgatcttcaaagtttcatcatagtctttcttg |
51434887 |
T |
 |
| Q |
101 |
gaa |
103 |
Q |
| |
|
||| |
|
|
| T |
51434886 |
gaa |
51434884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University