View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8685_low_9 (Length: 244)

Name: NF8685_low_9
Description: NF8685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8685_low_9
NF8685_low_9
[»] chr1 (2 HSPs)
chr1 (130-233)||(51434754-51434857)
chr1 (1-103)||(51434884-51434986)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 6e-52; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 130 - 233
Target Start/End: Complemental strand, 51434857 - 51434754
Alignment:
130 cttatgtaaaatataatgacgatatgttcagtagttattaatgcaactagatctaatgtgcattatgggtgattttgtaggttttgattttgatgtttga 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51434857 cttatgtaaaatataatgacgatatgttcagtagttattaatgcaactagatctaatgtgcattatgggtgattttgtaggttttgattttgatgtttga 51434758  T
230 tgtc 233  Q
    ||||    
51434757 tgtc 51434754  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 51434986 - 51434884
Alignment:
1 taactaccgatatatcttgatgtatgattgcttttattgtaatgccttaataattatagaagtttgcttgatcttcaaagtttcatcatagtctttcttg 100  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51434986 taactaccgatatatcttgatgtatgattgcttttattgtaacgccttaataattatagaagtttgcttgatcttcaaagtttcatcatagtctttcttg 51434887  T
101 gaa 103  Q
    |||    
51434886 gaa 51434884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University