View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8686_high_8 (Length: 287)
Name: NF8686_high_8
Description: NF8686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8686_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 39 - 266
Target Start/End: Original strand, 18834448 - 18834675
Alignment:
| Q |
39 |
gattattctcacaagccagcaaggcaaagaggagaagatttatgtcattcaataacatgttatgtaactcttgggttggaaaacgaagaactcactagca |
138 |
Q |
| |
|
||||||| ||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18834448 |
gattattatcacaagtcagcaaagcaaagaggagaagatttatgtcattcaataacatgttatgtaactcttgggttggaaaacgaagaactcactagca |
18834547 |
T |
 |
| Q |
139 |
aatgaaggggacaattcaggggattttatttccttacgatacggtagtttaacaatgtaaacataagtgaagatttcaacttaatttccttaaattacca |
238 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
18834548 |
aatgaaggggacaattcaggggattttctttccttatgatacggtagtttaacaatgtaaacataagtgaagatttcaacttaatttccttaaattacta |
18834647 |
T |
 |
| Q |
239 |
tcagtctacaactaccagaaattgaaaa |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
18834648 |
tcagtctacaactaccagaaattgaaaa |
18834675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University