View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8686_low_19 (Length: 261)
Name: NF8686_low_19
Description: NF8686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8686_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 234
Target Start/End: Original strand, 45122265 - 45122493
Alignment:
| Q |
17 |
cttctcactagcgtattatcactgatgtttcctttaagataaatggcaacactactaaattctcttccccaatatctgcacaaacaaggaaacattaaat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45122265 |
cttctcactagcgtattatcactgatgtttcctttaagataaatggcaacactactaaattcttttccccaatatctgcacaaacaaggaaacattaaat |
45122364 |
T |
 |
| Q |
117 |
aatcaacaaaattaaaaggcaacgattaggaattatgaattgttggatagtttggggtgcactaaacttgattaca-----------agtgatttgaagt |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
45122365 |
aatcaacaaaattaaaaggcaacgattaggaattatgaattgttggatagtttggggtgcgctaaacttgattacaacccattcactagtgatttgaagt |
45122464 |
T |
 |
| Q |
206 |
ctgtatttctttaaagtgacgcaaagcac |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45122465 |
ctgtatttctttaaagtgacgcaaagcac |
45122493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University