View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8686_low_8 (Length: 424)
Name: NF8686_low_8
Description: NF8686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8686_low_8 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 377; Significance: 0; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 377; E-Value: 0
Query Start/End: Original strand, 22 - 409
Target Start/End: Original strand, 898256 - 898641
Alignment:
| Q |
22 |
ttgggatcaaaaacaaaatgtagcactcttaattttgaaaccctctatactcagctacctcaaaccatcatagacgaaattattaacctttgtccagatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898256 |
ttgggatcaaaaacaaaatgtagcactcttaattttgaaaccctctatactcagctacctcaaaccatcatagacgaaattattaacctttgtccagatt |
898355 |
T |
|
| Q |
122 |
tcaatcccaatagagaaaatgttttatatttggccgaacaattccaactttttcgacacaaccaaggtcggttttacctgaattttgacatagagaggtg |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
898356 |
tcaatcccaatagagaaaatgttttatatttggccgaacaattccaactttttcgacacaaccaaggtcggttttacctgaattttgacat--agaggtg |
898453 |
T |
|
| Q |
222 |
ccaataccacccccatctcttgatctcaaatttggtgccttcattggcctaaaataattatgcacatactctgtctcttctgaatcattgaaaccttggt |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898454 |
ccaataccacccccatctcttgatctcaaatttggtgccttcattggcctaaaataattatgcacatactctgtctcttctgaatcattgaaaccttggt |
898553 |
T |
|
| Q |
322 |
cctactagcctatgttcttagtgctcttcccccaagaaaacctttctccaatgcattaaagtttacacaacatctcgtctttgatgtc |
409 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
898554 |
cctactagcctatgttcttagtgctcttcccccaagaaaacctttctccaatgcattaaagtttacacaacatctcgtctttgatgtc |
898641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University