View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_high_1 (Length: 564)
Name: NF8689_high_1
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 548; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 548; E-Value: 0
Query Start/End: Original strand, 1 - 556
Target Start/End: Original strand, 42431794 - 42432349
Alignment:
| Q |
1 |
ttctccgacaacggcctaccccgttccctcactttcccatcagacaattcctgatgcgattccacaagaattttaccgtctttccccacaacccgaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42431794 |
ttctccgacaacggcctaccccgttccctcactttcccatcagacaattcctgatgcgattccacaagaattttaccgtctttccccacaacccgaaccg |
42431893 |
T |
 |
| Q |
101 |
taacaacctgaacggttcgaactggaggttcagaatcatcaagcgaggtttctccctgagatagttcaagccaaagattgtgaacgttcttcgttccggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42431894 |
taacaacctgaacggttcgaactggaggttcggaatcatcaagcgaggtttctccctgagatagttcaagccaaagattgtgaacgttcttcgttccggg |
42431993 |
T |
 |
| Q |
201 |
cttaacaccccacgtggcgaaggaatctgaaggtaaacgaggtttaagccactcagaaagagattgcggagatacgaaattgcgacggttatttctgtta |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42431994 |
cttaacaccccacgtggcgaaggaatctgaaggtaaacgaggtttaagccattcagaaagagattgcggagatacgaaattgcgacggttatttctgtta |
42432093 |
T |
 |
| Q |
301 |
gggtttgaggaggaggatgatgataacgatgaggtggatatgttgttggacatggcggggattttgaggaaacgacgtggtttgagagggaaagagagga |
400 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42432094 |
gggtttgaggaggaggatgatgataacgatgaggtggatatgttgttggacatggcggggattttgaggaaacgacgtggtttgagagggaaagagagga |
42432193 |
T |
 |
| Q |
401 |
aaggacagtttgttgttgtgggggtgttgtgagatcttgaggaggtgaaaaggaagcaaacggagagtgcagttagtaaaagatcaggtaaggaagggag |
500 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42432194 |
aaggacagtttgttgttgtgggggtgttgtgagatcttgaggaggtgaaaaggaagcaaacggagagtgcagttagtaaaagatcaggtaaggaagggag |
42432293 |
T |
 |
| Q |
501 |
attgagatttgttagtggttgtaacggtggggacatttcaatttcaaacgaggtgg |
556 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42432294 |
attgagatttgttagtggttgtaacggtggggacatttcaatttcaaacgaggtgg |
42432349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University