View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_high_13 (Length: 275)
Name: NF8689_high_13
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 250
Target Start/End: Original strand, 52798871 - 52799122
Alignment:
| Q |
1 |
tatgtgttgtccaataacaaagctcattaaaaatatggcatgaatgtacaataaaggaatcaggtccaagtccaccaagacgaccacctcgtctcttagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
52798871 |
tatgtgttgtccaataacaaagctcattaaaaatatggcatgaatgtacaataaaggaatcaggtccaagtccaccaaggcgaccacctcgtctcttagc |
52798970 |
T |
|
| Q |
101 |
atgatgcaacacaaaatcttcctaaaattggatagccatcttattcccaagcttcctaaaaatcgaaatttggagtgaaccgccttcacaatccttcatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |
|
|
| T |
52798971 |
atgatgcaacacaaaatcttcctaaaattggatagtcatcttattcccaagcttcctaaaaattaaaatttggagtgaaccgccttcacaatccttcacc |
52799070 |
T |
|
| Q |
201 |
aca--cacaacttaagtccttccaccaacgcgatacaattcattttacaaaa |
250 |
Q |
| |
|
||| |||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
52799071 |
acacccacaacttaagtccttccaccaacacggcacaattcattttacaaaa |
52799122 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University