View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_high_14 (Length: 270)
Name: NF8689_high_14
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_high_14 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 33 - 269
Target Start/End: Complemental strand, 48214363 - 48214127
Alignment:
| Q |
33 |
atactgaaacatattttatagttaacacatataaagatctcaaacacaaaatcaacataaacgtataagattacaaaccttttttagtattaaatggtga |
132 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
48214363 |
atactgaaacatattttatagttaacacacataaagatctcaaacacaaaatcaccataaacgtataagattacaaaccttttttagaattaaatggtga |
48214264 |
T |
 |
| Q |
133 |
gaacacatgcgtttgcccataaagcgtaaacatagatagatcaaacatgcataaacacacaaggttttgaaatatgagtataaaacatgagataatgaaa |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48214263 |
gaacacatgcgtttgcccataaagcgtaaacatagatagatcgaacatgcataaacacacaaggttttgaaatatgagtataaaacatgagataatgaaa |
48214164 |
T |
 |
| Q |
233 |
ttacatagattcaggttgaatgaacatacatacagat |
269 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48214163 |
ttacaatgattcaggttgaatgaacatacatacagat |
48214127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University