View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_high_15 (Length: 267)
Name: NF8689_high_15
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 41794415 - 41794652
Alignment:
| Q |
13 |
ataatactataactaaatt-gattttaaacaatatttattgttgatttgaatcagacgattgagatttaaaattactacaacaaatttgtttccaaatac |
111 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41794415 |
ataatactataactaaatttgattttagacaatatttattgttgatttgaatcagacaattgagatttaaaattactacaacaaatttgttttcaaatac |
41794514 |
T |
 |
| Q |
112 |
tacaatgtgaaatatctttgaaattagaaaaattattcgattggatttcttgaaagctgtttttagctatagaccattttacatgtatagtttaatattt |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41794515 |
tacaatgtgaaatatctttgaaattagaaaaattattcgattggatttcttgaaagctgtttttggctatagaccattttacatgtatagtttaatattt |
41794614 |
T |
 |
| Q |
212 |
gtgcttctcgattttgattacatcaatgaaggattatc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41794615 |
gtgcttctcgattttgattacatcaatgaaggattatc |
41794652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University