View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_high_16 (Length: 250)
Name: NF8689_high_16
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_high_16 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 164
Target Start/End: Original strand, 1503713 - 1503872
Alignment:
| Q |
1 |
cacacattaaatataacgataaaaatataaagtcggtttgaatatgtatatctataacttatcacatgtctaacattttatagtatgagttgtacgtaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||||| ||||||||||||||| | |
|
|
| T |
1503713 |
cacacattaaatataacgataaaaatataaagtcggttcgaatatgtatatccataacttatcacatgtctagcattttataatatgagttgtacgtata |
1503812 |
T |
|
| Q |
101 |
ttgagaaccatctacagagaaccatctacacttatatatgtataaatgatatgttagggttgtt |
164 |
Q |
| |
|
||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
1503813 |
ttgagaaccatctacagagaaccatctac----atttatgtataaatgatatgttagggttgtt |
1503872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University