View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_high_20 (Length: 242)
Name: NF8689_high_20
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_high_20 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 82 - 228
Target Start/End: Complemental strand, 3297138 - 3296992
Alignment:
| Q |
82 |
tatagagtatatataatatgaatttacaatgaaaaataaaaacttgaaggtgatcaatcaaatcaacacaagcctttttgctcccaactagtttgtcttc |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3297138 |
tatagagtatatataatatgaatttacaatgaaaaataaaaacttgaaggtgatcaatcaaatcaacacaagcctttttgctcccaactagtttgtcttc |
3297039 |
T |
 |
| Q |
182 |
cacatacatacacccaccaaccagaacccatgtgggctatctctgct |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3297038 |
cacatacatacacccaccaaccagaacccatgtgggctatctctgct |
3296992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University