View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF8689_low_16 (Length: 270)

Name: NF8689_low_16
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF8689_low_16
NF8689_low_16
[»] chr4 (1 HSPs)
chr4 (33-269)||(48214127-48214363)


Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 33 - 269
Target Start/End: Complemental strand, 48214363 - 48214127
Alignment:
33 atactgaaacatattttatagttaacacatataaagatctcaaacacaaaatcaacataaacgtataagattacaaaccttttttagtattaaatggtga 132  Q
    ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||    
48214363 atactgaaacatattttatagttaacacacataaagatctcaaacacaaaatcaccataaacgtataagattacaaaccttttttagaattaaatggtga 48214264  T
133 gaacacatgcgtttgcccataaagcgtaaacatagatagatcaaacatgcataaacacacaaggttttgaaatatgagtataaaacatgagataatgaaa 232  Q
    |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48214263 gaacacatgcgtttgcccataaagcgtaaacatagatagatcgaacatgcataaacacacaaggttttgaaatatgagtataaaacatgagataatgaaa 48214164  T
233 ttacatagattcaggttgaatgaacatacatacagat 269  Q
    |||||  ||||||||||||||||||||||||||||||    
48214163 ttacaatgattcaggttgaatgaacatacatacagat 48214127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University