View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_low_20 (Length: 250)
Name: NF8689_low_20
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 36078515 - 36078279
Alignment:
| Q |
1 |
atgggaatggaaaaatgaatattattgaaaatagtgggagaagtatattattaatacttaacccacctatcgataaagtatatgttatttatactgtgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36078515 |
atgggaatggaaaaatgaatattattgaaaatagtgggagaagtatattattaatacttaacccacctatcgataaagtatatgttatttatactgtgtt |
36078416 |
T |
 |
| Q |
101 |
ttgacttagtttggaggctttgccgacccacataccgagttagtgtcatcgagaaagaatcaattccctatctcggctactctagcatcgcctaaccttc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
36078415 |
ttgacttagtttggaggctttgccgacccacataccgagttagtgtcatcgagaaagaatcaattccttatctcggctactctagcatcgcctaaccttc |
36078316 |
T |
 |
| Q |
201 |
aataaattgggaggattccttgcctaatagtataatc |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36078315 |
aataaattgggaggattccttgcctaatagtataatc |
36078279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 6 - 39
Target Start/End: Complemental strand, 36078543 - 36078510
Alignment:
| Q |
6 |
aatggaaaaatgaatattattgaaaatagtggga |
39 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
36078543 |
aatggaaaaatgaatattattgaaaataatggga |
36078510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University