View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_low_27 (Length: 236)
Name: NF8689_low_27
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_low_27 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 17 - 226
Target Start/End: Complemental strand, 7431022 - 7430820
Alignment:
| Q |
17 |
cacagacaccggacatgttgacaccggtaatagtattaaaacatgtaatattgaatgtaactgtatgtgaagtcttggtggttggtgctatatgggttat |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
7431022 |
cacagacaccggacatgttgacaccggtaatagtattaaaacatgtaatattgaatgtaactggatgtgaagtcttggtg-------ctatatgggttat |
7430930 |
T |
 |
| Q |
117 |
atagaacttgattttgttttgattactgtgaaggtgatcgttttgaaattgtgtttgcttgaatagctagcttacttttgcattagatgaaagattggtt |
216 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7430929 |
atagaacttgattttgttttgaatagtgtgaaggtgatcgttttgaaattgtgtttgcttgaatagctagcttacttttgcattagatgaaagattggtt |
7430830 |
T |
 |
| Q |
217 |
ttgatgtcca |
226 |
Q |
| |
|
|||||||||| |
|
|
| T |
7430829 |
ttgatgtcca |
7430820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University