View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_low_28 (Length: 235)
Name: NF8689_low_28
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 11 - 214
Target Start/End: Original strand, 484715 - 484918
Alignment:
| Q |
11 |
tagattattctgcttaggatattttccagtataaaccgcgtctgagaaaaacatctgaaacgagtaccgaacttgacaaagttcataccataccattgca |
110 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
484715 |
tagatcattctgcttaggatattttccagtataaaccgcgtctgaaaaaaacatctgaaacgagtaccgaacttgacaaagttcataccataccattgca |
484814 |
T |
|
| Q |
111 |
tcctcactcttacacctattcattaaatctttgcttgctttctcaatgcattctttgcaaactgtggagtttgttatgtctcctctgcatagtgcctgtc |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
484815 |
tcctcactcttacacctattcattaaatctttgcttgctttctcaatgcattctttgcaaactgtggagtttgttatgtctcctctgcatagtgcctgtc |
484914 |
T |
|
| Q |
211 |
cata |
214 |
Q |
| |
|
|||| |
|
|
| T |
484915 |
cata |
484918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University