View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_low_32 (Length: 231)
Name: NF8689_low_32
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 213
Target Start/End: Original strand, 38174943 - 38175162
Alignment:
| Q |
1 |
ataaatgtaatcaaatgaagtatatattggtgg---agtattgatgaattaagttcaatcaattctctcactatatattttctttgtt----ttcttttc |
93 |
Q |
| |
|
|||||||||| || ||||| ||||||||||||| |||||||||||||||| ||||||||||||||||||||||| |||| ||| || |||||||| |
|
|
| T |
38174943 |
ataaatgtaaccagatgaaatatatattggtggtggagtattgatgaattaaattcaatcaattctctcactatatttttttttttttgtttttcttttc |
38175042 |
T |
|
| Q |
94 |
attctatacatagcccctaaaaggttataagtaagatgatatctattcaaagataatttttgtgggggaggtgggtgggatagaggtaaataagatttgt |
193 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38175043 |
attctatacaaagcccctaaaaggttataactaagatgatatctatttaaagataatttttgtgggggaggtgggtgggatagaggtaaataagatttgt |
38175142 |
T |
|
| Q |
194 |
tgggttagcttagatcatat |
213 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
38175143 |
tgggttagcttagatcatat |
38175162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University