View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8689_low_36 (Length: 219)
Name: NF8689_low_36
Description: NF8689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8689_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 1 - 202
Target Start/End: Complemental strand, 18938712 - 18938511
Alignment:
| Q |
1 |
tgctgctatgtcgttctattcatgtgccactgatcaaacttgattcattctccatttgtcgttgctttgcacgtacatgttgccattgatataaagattc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18938712 |
tgctgctatgccgttctattcatgtgccactgatcaaacttgattcattctccatttgtcgttgctttgcgcgtacatgttgccattgatataaagattc |
18938613 |
T |
|
| Q |
101 |
acgcgccaacccaattgatattgcaggtcgtgtttccgcatcatcccatagtctatcatttcttcgctttcaaatacaccacatggtcatagcaaacata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
18938612 |
acgcgccaacccaattgatattgcaggtcgtgtttccacatcatcccatagtctatcatttctacgctttcaaatacaccacatggtcatagcaaacata |
18938513 |
T |
|
| Q |
201 |
tg |
202 |
Q |
| |
|
|| |
|
|
| T |
18938512 |
tg |
18938511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University