View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8690_low_2 (Length: 300)
Name: NF8690_low_2
Description: NF8690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8690_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 67 - 127
Target Start/End: Original strand, 25028616 - 25028676
Alignment:
| Q |
67 |
tacaaaagaggagtgatatccaaattcttagtgaagaaaaaattgatgaaattttgaatga |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
25028616 |
tacaaaagaggagtgatatccaaattcttactgaagaaaaaattgatgaaactttgaatga |
25028676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 8e-21
Query Start/End: Original strand, 208 - 271
Target Start/End: Original strand, 25861549 - 25861612
Alignment:
| Q |
208 |
gatatgaatcatggtaatggtgttctaacatctgatgaaggtgctgaacctattgtgagattgg |
271 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
25861549 |
gatatgactcatggtaatggtgctctaacatctgatgaaggtgctgaacctattgtgaaattgg |
25861612 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 78 - 205
Target Start/End: Original strand, 25861333 - 25861461
Alignment:
| Q |
78 |
agtgatatccaaattcttagtgaagaaaaaattgatgaaattttgaatgaaattccaaaggattataa-gaaggttcactagaaaccaaaggatggcctc |
176 |
Q |
| |
|
|||||| || ||| ||||| |||||||| ||||||||||| |||||||| ||| |||||||||||| || ||||||| ||||||||||| ||||||| |
|
|
| T |
25861333 |
agtgatgtcgaaaatcttaccgaagaaaagattgatgaaatcatgaatgaatttctaaaggattataaggagggttcacatgaaaccaaaggttggcctc |
25861432 |
T |
|
| Q |
177 |
tagctaattctgcatatactgtttcaaaa |
205 |
Q |
| |
|
| | ||||||||||| | |||||||||| |
|
|
| T |
25861433 |
aatcaaattctgcatacattgtttcaaaa |
25861461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University