View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8690_low_3 (Length: 261)
Name: NF8690_low_3
Description: NF8690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8690_low_3 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 136; Significance: 5e-71; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 136; E-Value: 5e-71
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 25059102 - 25059252
Alignment:
| Q |
1 |
accaataacacaagggttaatcattgtcgacaaaattttataatcacattcaaatataaacaaaaacttatgtgtgttgtgaaccttattcagcaagatc |
100 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25059102 |
accaataacacaagggtcaatcattgtcgacaaaattttataatcacattcaaatataaacaaaaacttatgtgtgttgtgaaccttattcagcaagatc |
25059201 |
T |
 |
| Q |
101 |
attatagtagtatgtttaatactatgtaaatcaatataatcttctcaatttgac |
154 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25059202 |
atta---tagtatgtttaatactatgtaaatcaatataatcttctcaatttgac |
25059252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 209 - 243
Target Start/End: Original strand, 25059306 - 25059340
Alignment:
| Q |
209 |
ggacaatacttgtagatcaataccttaggaaaaat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
25059306 |
ggacaatacttgtagatcaataccttaggaaaaat |
25059340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University