View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8692_low_2 (Length: 337)
Name: NF8692_low_2
Description: NF8692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8692_low_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 5442842 - 5442563
Alignment:
| Q |
1 |
ttggtattgtgaaagatgtttaacggtatacatttggcacaatttgtaaaataagatagatgaaaacacttttatatggataaaatatgataaannnnnn |
100 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5442842 |
ttggtattgtgatagatgtttaacggtatacatttgtcccaatttgtaaaataagatagatgaaaacacttttatatggataaaatatgataattttttt |
5442743 |
T |
 |
| Q |
101 |
nnnnnnnn-----gcaaaagcaataaaaccatgattagaatcttaatttttggttgggttataatgagaatgataactaaggggccccttatctcctaat |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5442742 |
ttttttgttttttgcaaaagcaataaaaccatgattagaatcttaatttttggttgggttataatgagaatgataactaaggggccccttatctcctaat |
5442643 |
T |
 |
| Q |
196 |
gtgagtcacgcatttgtttccctctcatctcaatccatttctaatctataaggcagataagcacttgcatcactctccct |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5442642 |
gtgagtcacgcatttgtttccctctcatctcaatccatttctaatctataaggcagataagcacttgcatcactctccct |
5442563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University