View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8693_high_4 (Length: 286)
Name: NF8693_high_4
Description: NF8693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8693_high_4 |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0102 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 31694 - 31962
Alignment:
| Q |
1 |
gaaggaccttcaactagtggtagagagaggatcacagattttaaataaagcaagagccgaaattgttgattttaccagcaatgcagatgtaactaatgaa |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31694 |
gaaggacctccaactagtggtagagagaggatcacagattttaaataaagcaagagccgaaattgttgattttaccagcaatgcagatgtaactaatgaa |
31793 |
T |
 |
| Q |
101 |
cctggtcactacgttatctactgggagattaaaggagaggtagatgacaatgtacttgatgattgttgcagagaaatggacctatcttttgctgatcatg |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31794 |
cctggtcactacgttatttactgggagattaaaggagaggtagatgacaatgtacttgatgattgttgcagagaaatggacctatcttttgctgatcatg |
31893 |
T |
 |
| Q |
201 |
gatatgtagtgtcaagaaaaacaaattcaattgggccacttgaactttgcattttggagagagggactt |
269 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31894 |
gatatgtagtgtcaagaaaaacaaattcaattgggccacttgaactttgcattttggagagagggactt |
31962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University