View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8693_low_3 (Length: 287)
Name: NF8693_low_3
Description: NF8693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8693_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 23 - 273
Target Start/End: Original strand, 29322217 - 29322467
Alignment:
| Q |
23 |
agtagcagagaaacgatttcggttcttgtttgtagcggagggtggagttcgaggattttggcaagcttcaatgagaagccattaacgtaatggtgtgcga |
122 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
29322217 |
agtagaagagaaacgatttcggttcttgtttgcagcggagggtggagttcgaggattttggcaagcttcaatgagaagccattaatgtaatggtgtgcga |
29322316 |
T |
 |
| Q |
123 |
atgatttaaagattttcattaaagattcgctattggtttgagtgtattcttcgattgcttgttgcagcgatgcgaggtcgttggatccgagcaatcttgt |
222 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29322317 |
atgatttaaagattttcattaaagattcgttattggtttgagtgtattcttcgattgcttgttgcagcgatgcgaggtcgttggatccgagcaatcttgt |
29322416 |
T |
 |
| Q |
223 |
tgcgtgttcttgaagttggaggccgtggatgagtgatttatcttggttgtg |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29322417 |
tgcgtgttcttgaagttggaggccgtggatgagtgatttatcttggttgtg |
29322467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 156 - 270
Target Start/End: Original strand, 29305161 - 29305275
Alignment:
| Q |
156 |
tggtttgagtgtattcttcgattgcttgttgcagcgatgcgaggtcgttggatccgagcaatcttgttgcgtgttcttgaagttggaggccgtggatgag |
255 |
Q |
| |
|
||||||||| |||||| |||||||||| ||||| ||| | ||||||||||||| ||| || ||| ||||||| | |||||| || |||||||||||| |
|
|
| T |
29305161 |
tggtttgagagtattcatcgattgcttcttgcaacgacgagaggtcgttggataggagaaacctttcggcgtgttgtcgaagttcgaagccgtggatgag |
29305260 |
T |
 |
| Q |
256 |
tgatttatcttggtt |
270 |
Q |
| |
|
|||| | |||||||| |
|
|
| T |
29305261 |
tgatctgtcttggtt |
29305275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University