View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8693_low_6 (Length: 240)
Name: NF8693_low_6
Description: NF8693
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8693_low_6 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 38933201 - 38933433
Alignment:
| Q |
1 |
attaccaaactattttgaattggtctttagtctccttttacactcccttgcaaactcatggatgaatgattatgaactc--taagtttatagcaacattg |
98 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38933201 |
attaacaaactattttgaattggtctttggtctccttttacactcccttgcaaactcatggatgaatgattatgaactctttaagtttatagcaacattg |
38933300 |
T |
|
| Q |
99 |
aagaactatcacctgaagaaat-----ttcaact----ttgttcttttgcctgactagattaatagatagtccaaacaaacgtcttttctttgaattctt |
189 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38933301 |
aagaactatcacctgaagaaatttttattcaatttttattgttcttttgcctgactagattaatagatagtccaaactaacgtcttttctttgaattctt |
38933400 |
T |
|
| Q |
190 |
cttaatatcattttgtctctttttctctgtgat |
222 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38933401 |
cttaatatcattttgtctctttttctctgtgat |
38933433 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University