View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8694_low_3 (Length: 311)
Name: NF8694_low_3
Description: NF8694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8694_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 2154144 - 2154331
Alignment:
| Q |
1 |
tttggtattccactaaggacgtaacttgaatgaataaatgtcgacacnnnnnnnntctatagtatcaataagtgcatcacacaaaaacaaatatcaccgc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2154144 |
tttggtattccactaaggacgtaacttgaatgaataaatgtcgacacaaaaaaa-tctatagtatcaataagtgcatcacacaaaaacaaatatcaccgc |
2154242 |
T |
 |
| Q |
101 |
aaatgaaaatgactatattctttacatttatctgag--aaataaaattaaaacaattaaagtatgaaaatttgtttgaaaaagctagta |
187 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2154243 |
aaatgaaaatgactatattctttacatttatctgagaaaaaaaaaattaaaacaattaaagtatgaaaatttgtttgaaaaagctagta |
2154331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 222 - 258
Target Start/End: Original strand, 2154327 - 2154363
Alignment:
| Q |
222 |
tagtatatcaaatagtttgtgttattttaacttgtta |
258 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2154327 |
tagtatatcaaatagtttgtgttattttaacttgtta |
2154363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University