View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8696_high_1 (Length: 490)
Name: NF8696_high_1
Description: NF8696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8696_high_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 452; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 452; E-Value: 0
Query Start/End: Original strand, 18 - 485
Target Start/End: Complemental strand, 5955182 - 5954715
Alignment:
| Q |
18 |
tttcatactagatttgcttctgggaattcagattggtaaaccagatttaaaaggacttgttgcaaatctagcactcagattcttcgaccctttaatgcca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5955182 |
tttcatactagatttgcttctgggaattcagattggtaaaccagatttgaaaggacttgttgcaaatctagcactcagattcttcgaccctttaatgcca |
5955083 |
T |
 |
| Q |
118 |
acagatgaaccattaacaaaaagtgatagaaataaactggaatcaacatttagaaaaagcactaccaacgccacctttgatcctttatccgaccaaggag |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
5955082 |
acagatgaaccattaacaaaaagtgatagaaataaactggaatcaacatttagaaaaagcactaccaatgccacctttgatcctttatccgaccaaggag |
5954983 |
T |
 |
| Q |
218 |
gtcttcactgtctcgatgtatttagacgaagcttattgcgctcaggacctcaaccagcacctagaatatggatcagacgcaggtcgaacgctaatagagt |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5954982 |
gtcttcactgtctcgatgtatttagacgaagcttattgcgctcaggacctcaaccagcacctagaatatggatcaaacgcaggtcgaacgctaatagagt |
5954883 |
T |
 |
| Q |
318 |
tgcagacaaacggcgccagcaactgatacattgtgtaactgagctaaaagaggctggaatcaagttcaagaaaaggaagaccgatcgcttctgggatatt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5954882 |
tgcagacaaacggcgccagcaactgatacattgtgtaactgagctaaaagaggctggaatcaagttcaagaaaaggaagaccgatcgcttctgggatatt |
5954783 |
T |
 |
| Q |
418 |
aaatttaaggacggtattctgcgtattccgagactcttgatccatgatggaacaaaatctctgcttct |
485 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
5954782 |
aaatttaaggacggtattctgcgtattccgagactcttgatccatgatggaacaaaatctctgtttct |
5954715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University