View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8697_high_6 (Length: 266)
Name: NF8697_high_6
Description: NF8697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8697_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 237
Target Start/End: Original strand, 7432278 - 7432497
Alignment:
| Q |
18 |
agtatgtgtctatgtgtcttgcgatattcttttattttatttttctatcgttcgttggtgttctaatacaatcattcgactatttagacttcgtttgacc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7432278 |
agtatgtgtctatgtgtcttgcgatattcttttattttatttttttatcgtttgttggtgttctaatacaatcattcgactatttagacttcatttgacc |
7432377 |
T |
 |
| Q |
118 |
ttaattggttggtggtttattttcaactaattgtaacatatgtaatcttttttcatagctaatatttttattagatttgcttcttgttccaaattattga |
217 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7432378 |
ttaattgattggtggtttattttcaactaagtgtaacatatgtaatcttttttcatagttaatctttttattagatttgcttcttgttccaaattattga |
7432477 |
T |
 |
| Q |
218 |
tccttttttctcttcttctc |
237 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
7432478 |
accttttttctcttcttctc |
7432497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University