View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8697_low_10 (Length: 262)
Name: NF8697_low_10
Description: NF8697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8697_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 244
Target Start/End: Complemental strand, 9451877 - 9451634
Alignment:
| Q |
1 |
accgcctaacaaccttggtgagaatagcgtcggcaacggaaacggcagatgaaattattcaatgagataggaaaaaggtcgagagtgaagtgacgatgtg |
100 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||||||||||||||| |||||||||| |||||||||||||||||| ||| ||||| |||| ||||||||| |
|
|
| T |
9451877 |
accgcctaacgaccttggtgagaatagtgtcggcaacggaaacggtagatgaaatttttcaatgagataggaaaagggttgagagagaagcgacgatgtg |
9451778 |
T |
 |
| Q |
101 |
aatggtttctcagaggccaaaatatgaaatttaaagaacactgttaaggctttggaagatatattgcatagaaagtgttccatgaatgctacaaatgagc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9451777 |
aatggtttctcagaggccaaaatatgaaatttaaagaacaccgttaaggccttggaagaaatattgcatagaaagtgttccatgaatgctacaaatgagc |
9451678 |
T |
 |
| Q |
201 |
tgctttagaagtagttgatgaattggaattaaaattgagaaaag |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9451677 |
tgctttagaagtagttgatgaattggaattagaattgagaaaag |
9451634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University