View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8697_low_18 (Length: 224)
Name: NF8697_low_18
Description: NF8697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8697_low_18 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 106 - 206
Target Start/End: Original strand, 3606422 - 3606519
Alignment:
| Q |
106 |
gtgtctaattattgttcagataaaggataggaaacatgcatagtcatttgcctgaaggttattattacaagagataaaaaattgtccaattttcgtatat |
205 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
3606422 |
gtgtctaattattgttcagataaaggataggaaacatgcatagtcatttgcccgaagg---ttattacaagagataaaaaattgtccaattatcctatat |
3606518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University