View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF8697_low_20 (Length: 221)
Name: NF8697_low_20
Description: NF8697
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF8697_low_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 135 - 203
Target Start/End: Original strand, 49976630 - 49976698
Alignment:
| Q |
135 |
tttatgactttgttaattattacaggagaccagatggaaatccattagaccttaacaatctgcctgatg |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49976630 |
tttatgactttgttaattattacaggagaccagatggaaatccattagaccttaacaatctgcctgatg |
49976698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 17 - 84
Target Start/End: Original strand, 49976525 - 49976587
Alignment:
| Q |
17 |
cacttactactacaccttcatagattgatctgatcatcttctcctcttcaacttctactctatttcct |
84 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49976525 |
cacttactactacaccttcatagattgat-----catcttctcctcttcaacttctactctatttcct |
49976587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University